Le diabète MODY-2 et le gène de la glucokinase

Dernière modification
Mardi 6 décembre 2016
Licence de l'article
Présentation

Présentation de formes rares de diabètes, les MODY (Maturity Onset Diabetes of the Young). Proposition d'activité de comparaison de séquences des allèles sauvages et mutés dans le cas du MODY-2. Liaison génotype-phénotype.

Retour au début

Le diabète MODY

On distingue en général deux grands types de diabètes : le diabète de type I (insulino-dépendant) et le diabète de type II (non-insulino-dépendant). Si ces deux ensembles couvrent la majorité des cas, certains diabètes sont classés à part. Parmi ceux-ci, l’un des plus importants est le diabète MODY (Maturity Onset Diabetes of the Young). Selon les auteurs, le diabète MODY est classé parmi les diabètes de type II, ou mis à part. Nous allons considérer ici MODY comme appartenant aux diabètes de type II. Ce diabète touche des sujets de moins de 25 ans, et correspond à environ 5 % des diabètes de type II.

L’intérêt de ce diabète est qu’il est assez bien caractérisé d’un point de vue génétique. Contrairement à la grande majorité des diabètes, pour lesquels on ne connaît que des gènes de prédisposition (c’est-à-dire que la mutation n’entraîne pas à 100 % l’apparition de la maladie, l’environnement jouant un rôle important dans le déclenchement de la maladie) les diabètes MODY sont des maladies monogéniques (c’est-à-dire causées par la mutation d’un seul gène).

Retour au début

MODY et les gènes

On connaît 5 types de diabète MODY, correspondant à 5 gènes mutés :

  1. MODY-1 : HNF-4alpha (Hepatocyte Nuclear Factor)
  2. MODY-2 : Glucokinase (Hexokinase hépatique)
  3. MODY-3 : HNF-1alpha
  4. MODY-4 : IPF-1 (Insulin Promoteur Factor)
  5. MODY-5 : HNF-1beta (forme de diabète MODY rare)

MODY-2 représente 50 % des cas, MODY-1 et MODY-3 30 %, et les autres formes les 20 % restant.

Retour au début

MODY-2 et la glucokinase

On peut se servir du diabète MODY-2 pour montrer un exemple de liaison génotype – phénotype dans le cas du diabète.

Le gène de la glucokinase a été cloné : il code une protéine de 465 acides aminés. Une mutation non-sens au niveau du codon 279 de ce gène a été trouvée chez des individus atteints de diabète MODY-2 :

Figure 1 : le gène et la protéine glucokinase
Gène glucokinase

(831)GAC GAG AGC TCT(842)

Protéine glucokinase

(278)Asp Gln Ser Ser(281)

Gène muté MODY-2

(831)GAC TAG AGC TCT(842)

Protéine mutée MODY-2

(278)Asp *

Retour au début

Retour au début

Utilisation pédagogique

Il est possible de réaliser des alignements de l’allèle sauvage et de l’allèle muté grâce au logiciel Anagène par exemple, puis de comparer les protéines. Pour cela, copier les textes suivants :

glucokinase.adn

; ADN brin non transcrit
; Glucokinase humaine
; séquence codante uniquement
; forme sauvage fonctionnelle
;
ATGCTGGACGACAGAGCCAGGA
TGGAGGCCGCCAAGAAGGAGAAGGTAGAGCAGATCCTGGCAGAGTTCCAGCTGCAGGAGG
AGGACCTGAAGAAGGTGATGAGACGGATGCAGAAGGAGATGGACCGCGGCCTGAGGCTGG
AGACCCATGAAGAGGCCAGTGTGAAGATGCTGCCCACCTACGTGCGCTCCACCCCAGAAG
GCTCAGAAGTCGGGGACTTCCTCTCCCTGGACCTGGGTGGCACTAACTTCAGGGTGATGC
TGGTGAAGGTGGGAGAAGGTGAGGAGGGGCAGTGGAGCGTGAAGACCAAACACCAGATGT
ACTCCATCCCCGAGGACGCCATGACCGGCACTGCTGAGATGCTCTTCGACTACATCTCTG
AGTGCATCTCCGACTTCCTGGACAAGCATCAGATGAAACACAAGAAGCTGCCCCTGGGCT
TCACCTTCTCCTTTCCTGTGAGGCACGAAGACATCGATAAGGGCATCCTTCTCAACTGGA
CCAAGGGCTTCAAGGCCTCAGGAGCAGAAGGGAACAATGTCGTGGGGCTTCTGCGAGACG
CTATCAAACGGAGAGGGGACTTTGAAATGGATGTGGTGGCAATGGTGAATGACACGGTGG
CCACGATGATCTCCTGCTACTACGAAGACCATCAGTGCGAGGTCGGCATGATCGTGGGCA
CGGGCTGCAATGCCTGCTACATGGAGGAGATGCAGAATGTGGAGCTGGTGGAGGGGGACG
AGGGCCGCATGTGCGTCAATACCGAGTGGGGCGCCTTCGGGGACTCCGGCGAGCTGGACG
AGTTCCTGCTGGAGTATGACCGCCTGGTGGACGAGAGCTCTGCAAACCCCGGTCAGCAGC
TGTATGAGAAGCTCATAGGTGGCAAGTACATGGGCGAGCTGGTGCGGCTTGTGCTGCTCA
GGCTCGTGGACGAAAACCTGCTCTTCCACGGGGAGGCCTCCGAGCAGCTGCGCACACGCG
GAGCCTTCGAGACGCGCTTCGTGTCGCAGGTGGAGAGCGACACGGGCGACCGCAAGCAGA
TCTACAACATCCTGAGCACGCTGGGGCTGCGACCCTCGACCACCGACTGCGACATCGTGC
GCCGCGCCTGCGAGAGCGTGTCTACGCGCGCTGCGCACATGTGCTCGGCGGGGCTGGCGG
GCGTCATCAACCGCATGCGCGAGAGCCGCAGCGAGGACGTAATGCGCATCACTGTGGGCG
TGGATGGCTCCGTGTACAAGCTGCACCCCAGCTTCAAGGAGCGGTTCCATGCCAGCGTGC
GCAGGCTGACGCCCAGCTGCGAGATCACCTTCATCGAGTCGGAGGAGGGCAGTGGCCGGG
GCGCGGCCCTGGTCTCGGCGGTGGCCTGTAAGAAGGCCTGTATGCTGGGCCAGTGA

mody2.adn

; ADN BRIN CODANT
; GLUCOKINASE HUMAINE
; MUTATION NON SENS TROUVEE CHEZ UN PATIENT MODY-2
; REF : NATURE 356, 721-722 (1991)
;
ATGCTGGACGACAGAGCCAGGA
TGGAGGCCGCCAAGAAGGAGAAGGTAGAGCAGATCCTGGCAGAGTTCCAGCTGCAGGAGG
AGGACCTGAAGAAGGTGATGAGACGGATGCAGAAGGAGATGGACCGCGGCCTGAGGCTGG
AGACCCATGAAGAGGCCAGTGTGAAGATGCTGCCCACCTACGTGCGCTCCACCCCAGAAG
GCTCAGAAGTCGGGGACTTCCTCTCCCTGGACCTGGGTGGCACTAACTTCAGGGTGATGC
TGGTGAAGGTGGGAGAAGGTGAGGAGGGGCAGTGGAGCGTGAAGACCAAACACCAGATGT
ACTCCATCCCCGAGGACGCCATGACCGGCACTGCTGAGATGCTCTTCGACTACATCTCTG
AGTGCATCTCCGACTTCCTGGACAAGCATCAGATGAAACACAAGAAGCTGCCCCTGGGCT
TCACCTTCTCCTTTCCTGTGAGGCACGAAGACATCGATAAGGGCATCCTTCTCAACTGGA
CCAAGGGCTTCAAGGCCTCAGGAGCAGAAGGGAACAATGTCGTGGGGCTTCTGCGAGACG
CTATCAAACGGAGAGGGGACTTTGAAATGGATGTGGTGGCAATGGTGAATGACACGGTGG
CCACGATGATCTCCTGCTACTACGAAGACCATCAGTGCGAGGTCGGCATGATCGTGGGCA
CGGGCTGCAATGCCTGCTACATGGAGGAGATGCAGAATGTGGAGCTGGTGGAGGGGGACG
AGGGCCGCATGTGCGTCAATACCGAGTGGGGCGCCTTCGGGGACTCCGGCGAGCTGGACG
AGTTCCTGCTGGAGTATGACCGCCTGGTGGACTAGAGCTCTGCAAACCCCGGTCAGCAGC
TGTATGAGAAGCTCATAGGTGGCAAGTACATGGGCGAGCTGGTGCGGCTTGTGCTGCTCA
GGCTCGTGGACGAAAACCTGCTCTTCCACGGGGAGGCCTCCGAGCAGCTGCGCACACGCG
GAGCCTTCGAGACGCGCTTCGTGTCGCAGGTGGAGAGCGACACGGGCGACCGCAAGCAGA
TCTACAACATCCTGAGCACGCTGGGGCTGCGACCCTCGACCACCGACTGCGACATCGTGC
GCCGCGCCTGCGAGAGCGTGTCTACGCGCGCTGCGCACATGTGCTCGGCGGGGCTGGCGG
GCGTCATCAACCGCATGCGCGAGAGCCGCAGCGAGGACGTAATGCGCATCACTGTGGGCG
TGGATGGCTCCGTGTACAAGCTGCACCCCAGCTTCAAGGAGCGGTTCCATGCCAGCGTGC
GCAGGCTGACGCCCAGCTGCGAGATCACCTTCATCGAGTCGGAGGAGGGCAGTGGCCGGG
GCGCGGCCCTGGTCTCGGCGGTGGCCTGTAAGAAGGCCTGTATGCTGGGCCAGTGA

Thème d’étude Anagène : diabete.edi

; Anagène – Fenetre Edition
; glucokinase.adn
; Type 1
; Dec 0
; ADN brin non transcrit Glucokinase humaine séquence codante uniquement
; forme sauvage fonctionnelle
;
ATGCTGGACGACAGAGCCAGGATGGAGGCCGCCAAGAAGGAGAAGGTAGAGCAGATCCTGGCAGAGTTCC
AGCTGCAGGAGGAGGACCTGAAGAAGGTGATGAGACGGATGCAGAAGGAGATGGACCGCGGCCTGAGGCT
GGAGACCCATGAAGAGGCCAGTGTGAAGATGCTGCCCACCTACGTGCGCTCCACCCCAGAAGGCTCAGAA
GTCGGGGACTTCCTCTCCCTGGACCTGGGTGGCACTAACTTCAGGGTGATGCTGGTGAAGGTGGGAGAAG
GTGAGGAGGGGCAGTGGAGCGTGAAGACCAAACACCAGATGTACTCCATCCCCGAGGACGCCATGACCGG
CACTGCTGAGATGCTCTTCGACTACATCTCTGAGTGCATCTCCGACTTCCTGGACAAGCATCAGATGAAA
CACAAGAAGCTGCCCCTGGGCTTCACCTTCTCCTTTCCTGTGAGGCACGAAGACATCGATAAGGGCATCC
TTCTCAACTGGACCAAGGGCTTCAAGGCCTCAGGAGCAGAAGGGAACAATGTCGTGGGGCTTCTGCGAGA
CGCTATCAAACGGAGAGGGGACTTTGAAATGGATGTGGTGGCAATGGTGAATGACACGGTGGCCACGATG
ATCTCCTGCTACTACGAAGACCATCAGTGCGAGGTCGGCATGATCGTGGGCACGGGCTGCAATGCCTGCT
ACATGGAGGAGATGCAGAATGTGGAGCTGGTGGAGGGGGACGAGGGCCGCATGTGCGTCAATACCGAGTG
GGGCGCCTTCGGGGACTCCGGCGAGCTGGACGAGTTCCTGCTGGAGTATGACCGCCTGGTGGACGAGAGC
TCTGCAAACCCCGGTCAGCAGCTGTATGAGAAGCTCATAGGTGGCAAGTACATGGGCGAGCTGGTGCGGC
TTGTGCTGCTCAGGCTCGTGGACGAAAACCTGCTCTTCCACGGGGAGGCCTCCGAGCAGCTGCGCACACG
CGGAGCCTTCGAGACGCGCTTCGTGTCGCAGGTGGAGAGCGACACGGGCGACCGCAAGCAGATCTACAAC
ATCCTGAGCACGCTGGGGCTGCGACCCTCGACCACCGACTGCGACATCGTGCGCCGCGCCTGCGAGAGCG
TGTCTACGCGCGCTGCGCACATGTGCTCGGCGGGGCTGGCGGGCGTCATCAACCGCATGCGCGAGAGCCG
CAGCGAGGACGTAATGCGCATCACTGTGGGCGTGGATGGCTCCGTGTACAAGCTGCACCCCAGCTTCAAG
GAGCGGTTCCATGCCAGCGTGCGCAGGCTGACGCCCAGCTGCGAGATCACCTTCATCGAGTCGGAGGAGG
GCAGTGGCCGGGGCGCGGCCCTGGTCTCGGCGGTGGCCTGTAAGAAGGCCTGTATGCTGGGCCAGTGA
;-
; mody2.adn
; Type 1
; Dec 0
; ADN BRIN non transcrit GLUCOKINASE HUMAINE MUTATION NON-SENS TROUVEE CHEZ
; UN PATIENT MODY-2 REF : NATURE 356, 721-722 (1991)
;
ATGCTGGACGACAGAGCCAGGATGGAGGCCGCCAAGAAGGAGAAGGTAGAGCAGATCCTGGCAGAGTTCC
AGCTGCAGGAGGAGGACCTGAAGAAGGTGATGAGACGGATGCAGAAGGAGATGGACCGCGGCCTGAGGCT
GGAGACCCATGAAGAGGCCAGTGTGAAGATGCTGCCCACCTACGTGCGCTCCACCCCAGAAGGCTCAGAA
GTCGGGGACTTCCTCTCCCTGGACCTGGGTGGCACTAACTTCAGGGTGATGCTGGTGAAGGTGGGAGAAG
GTGAGGAGGGGCAGTGGAGCGTGAAGACCAAACACCAGATGTACTCCATCCCCGAGGACGCCATGACCGG
CACTGCTGAGATGCTCTTCGACTACATCTCTGAGTGCATCTCCGACTTCCTGGACAAGCATCAGATGAAA
CACAAGAAGCTGCCCCTGGGCTTCACCTTCTCCTTTCCTGTGAGGCACGAAGACATCGATAAGGGCATCC
TTCTCAACTGGACCAAGGGCTTCAAGGCCTCAGGAGCAGAAGGGAACAATGTCGTGGGGCTTCTGCGAGA
CGCTATCAAACGGAGAGGGGACTTTGAAATGGATGTGGTGGCAATGGTGAATGACACGGTGGCCACGATG
ATCTCCTGCTACTACGAAGACCATCAGTGCGAGGTCGGCATGATCGTGGGCACGGGCTGCAATGCCTGCT
ACATGGAGGAGATGCAGAATGTGGAGCTGGTGGAGGGGGACGAGGGCCGCATGTGCGTCAATACCGAGTG
GGGCGCCTTCGGGGACTCCGGCGAGCTGGACGAGTTCCTGCTGGAGTATGACCGCCTGGTGGACTAGAGC
TCTGCAAACCCCGGTCAGCAGCTGTATGAGAAGCTCATAGGTGGCAAGTACATGGGCGAGCTGGTGCGGC
TTGTGCTGCTCAGGCTCGTGGACGAAAACCTGCTCTTCCACGGGGAGGCCTCCGAGCAGCTGCGCACACG
CGGAGCCTTCGAGACGCGCTTCGTGTCGCAGGTGGAGAGCGACACGGGCGACCGCAAGCAGATCTACAAC
ATCCTGAGCACGCTGGGGCTGCGACCCTCGACCACCGACTGCGACATCGTGCGCCGCGCCTGCGAGAGCG
TGTCTACGCGCGCTGCGCACATGTGCTCGGCGGGGCTGGCGGGCGTCATCAACCGCATGCGCGAGAGCCG
CAGCGAGGACGTAATGCGCATCACTGTGGGCGTGGATGGCTCCGTGTACAAGCTGCACCCCAGCTTCAAG
GAGCGGTTCCATGCCAGCGTGCGCAGGCTGACGCCCAGCTGCGAGATCACCTTCATCGAGTCGGAGGAGG
GCAGTGGCCGGGGCGCGGCCCTGGTCTCGGCGGTGGCCTGTAAGAAGGCCTGTATGCTGGGCCAGTGA
;-

Ces séquences correspondent à la seule partie codante du brin codant de l’ADN du gène. La mutation est au niveau de la base 834 : G → T, créant un codon STOP.

Retour au début

Pour citer cet article

Gilles Furelaud, Le diabète MODY-2 et le gène de la glucokinase, Planet-Vie, Mardi 15 janvier 2002, http://planet-vie.ens.fr/article/2045/diabete-mody-2-gene-glucokinase, voir