Aller au contenu principal
-m -m -m -m -m-mee -meeee
-meeeeee eeeeee
-mee
-meeee omy -mee -meeee
-meeeeee eeeeeeeeeeeeeeeeee -meeeeee-meeee
-meeee -meeee
-mee
-m -m-mee-meeee
Gh-3"f Funkpruipèm espth-3fesey/t="Renique" clSVT. Il a cienc ldepth-
-meeeepècli>Eni >
-m
omyee
-momy-meeeeee
omy
Ens-liee-blockxtemmeEns-liee-blockxte> -m -m-meeEns liée
-meeee -meeee
-mee
En/1391/tritherapiee-th-3retrevira-cellent"langs"fre"u-litrithérapieepth-3enitrevira-cehèmesspan>
-m
eeee
-mee
En/1528/petit-ver-farclasy/teolium-caass=eum-em/vass-omy/term/81ellent"langs"fre"u- petit vernup farcla T/teolium caass=eum :ienm/vassc20"omy/term/81ehèmesspan>
-m
eeee
-mee
SequêtclassGra2 "?hèmesspan>
-m
omyee
-momy-meeeeee
omy
-meeee -meeee
-mee omyee
-momy-meeeeee
omy
-m
omyee-meeeepè i36u eeee-mee omy-meeee
-m -m-m -meeee -m -m -m-m -meeee p cli>Enzdatasf-no-ryf-dde-meEnreabou r/cli>En/2045/dss=etomy-dy-2146/g-glucokinasen"sf-dept-dde -dde-rerm/-st-ry -dde-r="swl -full"> omy eeee omy ee
-l-cli>En field-rerm/-ogiety-nkfer-pag field-rlabel-above"> -mee
En
-meeeeeeeeeeee
omy-meeeeee
ee
-mee
-meeeeeeeeeeee
MODY (Me-evety Ons20"Dss=etos">f the Young). Py/pomi2 menu'a-depth-3"36" cl3">Oismenup sés" page" cref=lè-3">sauvasstaxonmuss=s"da/srm"spt2" clMODYss. LiOismengmy/term/-nomy/term/.
-meeeeeeee
<èmesspan> eeeeeeeeeeee
-m
eeeeee

Tablci creuati- Lae

-m -m-m -meeee
    -m -m-meeMODY 20"lpsth-nlspèm eeeeeeeeeeMODYss=20"lsfglucokinaseesm eeeeeeeeeeUmy/term/81" cldagf-deptpèm eeeeeeeeeeeeeeee -meeee
      -m -m-mee -momy-meeeeee -mo
o ee<7/mu//themes"tocmy-biEnzeoc toc-/li>e> -m -mee837"MODY 20"lpsth-nlspopm/81m eeeeeeeeee337"MODYss=20"lsfglucokinaseesopm/81m eeeeeeeeeeref=popm/81m eeeeeeeeeeumenUmy/term/81" cldagf-deptpopm/81m eeeeeeeeee o
o Reto/t="classbutpèm

Oenute-irmumy/teh-3">Gr2 " eux grandszerm/e" cldss="sf-s hrelcip rent">dss="sf- dnzerm/ Ipèm (insulino-asspenda/t)=20"lptp rent">dss="sf- dnzerm/ IIpèm (-dn-insulino-asspenda/t). Si age" cux -psembEns couv"sf-"lsfmajor"sf-depthpt2, agraainsldss="sf-sf-det/themes=s"àf art. Parmi agux-ci,h-’u/taxonplus imth-1taxonesptl- dss="sf- MODY (Me-evety Ons20"Dss=etos">f the Young). Seter"lpstaumy/te,tl- dss="sf- MODY esptthemes=f armi Ens dss="sf-sfdnzerm/ II,">Semis"àf art. N"ulaf=l"sf-dhildi clrê" clac- dss="sf- esptquildil esptemeez bi/tecar">Eucares=fd’u/tpoin" clavupth-3">Géné. Cemengient-a-dReto/t="classbutpèm

MODY 20"lpsth-nlsph2"

OendMODYs1 hreHNFc4alphanDkNFc4alphanDkNFc4alpharth-1tax"da/srm"sdcl=lenchem34" clasepmalads=) Ens dss="sf-sfMODY -det/ss=v/a% Fpthor)/ct> - asepmalad2=) EG81m eeeeee-sfMx eeeeee-henumnaîp)/ct> - asepmalad3=) Ens d1s="sf/ct> - asepmalad4=) EIP d1 (Ildss="s=s"nu-lin Fpthor)/ct> - asepmalad5=) Ens d1s df-s). Py4alphanDkNFc4alphpomi2)-m -m -m clapeeeeeeeMODY 20"lpsth-nlsph2"

Oend -mecto/é=) Eomycn-nuumth-ro -miternup46" ci/.Gitterocknpth-2 bltd>helphelp

(831)GAC GAG AGC TCT(842)u/tpelphelPro -miterocknpth-2 bltd>helphelp

(278)AspEG8nSemrSemr(281)u/tpelphelGitter"sdcl4alphd2bltd>helphelp

(831)GAC TAG AGC TCT(842)u/tpelphelPro -miter"sdcle4alphd2bltd>helphelp

(278)AspE*u/tpelphelge">MODY 20"lpsth-nlsph2"

OendMODY 20"lpsth-nlsph2"

Oend -m -m-mee3rnupcl=li >

omy-mupcl=li >"sdcl4grâé.t5z9983cielp9/themeso/t=""main-tquluiss. LiOismeesfmss--ro -mites. PaîpmelaanDkpiesfmss-iv/tII.g; ADN briet/n=g; ). Py4
on environneme ; ATGCTGGACGACAGAGCCAGGA TGGAGGCCGCCAAGAAGGAGAAGGTAGAGCAGATCCTGGCAGAGTTCCAGCTGCAGGAGG AGGACCTGAAGAAGGTGATGAGACGGATGCAGAAGGAGATGGACCGCGGCCTGAGGCTGG AGACCCATGAAGAGGCCAGTGTGAAGATGCTGCCCACCTACGTGCGCTCCACCCCAGAAG GCTCAGAAGTCGGGGACTTCCTCTCCCTGGACCTGGGTGGCACTAACTTCAGGGTGATGC TGGTGAAGGTGGGAGAAGGTGAGGAGGGGCAGTGGAGCGTGAAGACCAAACACCAGATGT ACTCCATCCCCGAGGACGCCATGACCGGCACTGCTGAGATGCTCTTCGACTACATCTCTG AGTGCATCTCCGACTTCCTGGACAAGCATCAGATGAAACACAAGAAGCTGCCCCTGGGCT TCACCTTCTCCTTTCCTGTGAGGCACGAAGACATCGATAAGGGCATCCTTCTCAACTGGA CCAAGGGCTTCAAGGCCTCAGGAGCAGAAGGGAACAATGTCGTGGGGCTTCTGCGAGACG CTATCAAACGGAGAGGGGACTTTGAAATGGATGTGGTGGCAATGGTGAATGACACGGTGG CCACGATGATCTCCTGCTACTACGAAGACCATCAGTGCGAGGTCGGCATGATCGTGGGCA CGGGCTGCAATGCCTGCTACATGGAGGAGATGCAGAATGTGGAGCTGGTGGAGGGGGACG AGGGCCGCATGTGCGTCAATACCGAGTGGGGCGCCTTCGGGGACTCCGGCGAGCTGGACG AGTTCCTGCTGGAGTATGACCGCCTGGTGGACGAGAGCTCTGCAAACCCCGGTCAGCAGC TGTATGAGAAGCTCATAGGTGGCAAGTACATGGGCGAGCTGGTGCGGCTTGTGCTGCTCA GGCTCGTGGACGAAAACCTGCTCTTCCACGGGGAGGCCTCCGAGCAGCTGCGCACACGCG GAGCCTTCGAGACGCGCTTCGTGTCGCAGGTGGAGAGCGACACGGGCGACCGCAAGCAGA TCTACAACATCCTGAGCACGCTGGGGCTGCGACCCTCGACCACCGACTGCGACATCGTGC GCCGCGCCTGCGAGAGCGTGTCTACGCGCGCTGCGCACATGTGCTCGGCGGGGCTGGCGG GCGTCATCAACCGCATGCGCGAGAGCCGCAGCGAGGACGTAATGCGCATCACTGTGGGCG TGGATGGCTCCGTGTACAAGCTGCACCCCAGCTTCAAGGAGCGGTTCCATGCCAGCGTGC GCAGGCTGACGCCCAGCTGCGAGATCACCTTCATCGAGTCGGAGGAGGGCAGTGGCCGGG GCGCGGCCCTGGTCTCGGCGGTGGCCTGTAAGAAGGCCTGTATGCTGGGCCAGTGAcher->g4s="3f-fMOnua46/g-"ss=etomediu-5"u- g; ADN BRIN CODANTg; GLUCOKINASE HUMAINEg; MUTATION NON SENS TROUVEE CHEZ UN PATIENT4alphd2g; REF=) ENATURE 356, 721-722 (1991) ; ATGCTGGACGACAGAGCCAGGA TGGAGGCCGCCAAGAAGGAGAAGGTAGAGCAGATCCTGGCAGAGTTCCAGCTGCAGGAGG AGGACCTGAAGAAGGTGATGAGACGGATGCAGAAGGAGATGGACCGCGGCCTGAGGCTGG AGACCCATGAAGAGGCCAGTGTGAAGATGCTGCCCACCTACGTGCGCTCCACCCCAGAAG GCTCAGAAGTCGGGGACTTCCTCTCCCTGGACCTGGGTGGCACTAACTTCAGGGTGATGC TGGTGAAGGTGGGAGAAGGTGAGGAGGGGCAGTGGAGCGTGAAGACCAAACACCAGATGT ACTCCATCCCCGAGGACGCCATGACCGGCACTGCTGAGATGCTCTTCGACTACATCTCTG AGTGCATCTCCGACTTCCTGGACAAGCATCAGATGAAACACAAGAAGCTGCCCCTGGGCT TCACCTTCTCCTTTCCTGTGAGGCACGAAGACATCGATAAGGGCATCCTTCTCAACTGGA CCAAGGGCTTCAAGGCCTCAGGAGCAGAAGGGAACAATGTCGTGGGGCTTCTGCGAGACG CTATCAAACGGAGAGGGGACTTTGAAATGGATGTGGTGGCAATGGTGAATGACACGGTGG CCACGATGATCTCCTGCTACTACGAAGACCATCAGTGCGAGGTCGGCATGATCGTGGGCA CGGGCTGCAATGCCTGCTACATGGAGGAGATGCAGAATGTGGAGCTGGTGGAGGGGGACG AGGGCCGCATGTGCGTCAATACCGAGTGGGGCGCCTTCGGGGACTCCGGCGAGCTGGACG AGTTCCTGCTGGAGTATGACCGCCTGGTGGACTAGAGCTCTGCAAACCCCGGTCAGCAGC TGTATGAGAAGCTCATAGGTGGCAAGTACATGGGCGAGCTGGTGCGGCTTGTGCTGCTCA GGCTCGTGGACGAAAACCTGCTCTTCCACGGGGAGGCCTCCGAGCAGCTGCGCACACGCG GAGCCTTCGAGACGCGCTTCGTGTCGCAGGTGGAGAGCGACACGGGCGACCGCAAGCAGA TCTACAACATCCTGAGCACGCTGGGGCTGCGACCCTCGACCACCGACTGCGACATCGTGC GCCGCGCCTGCGAGAGCGTGTCTACGCGCGCTGCGCACATGTGCTCGGCGGGGCTGGCGG GCGTCATCAACCGCATGCGCGAGAGCCGCAGCGAGGACGTAATGCGCATCACTGTGGGCG TGGATGGCTCCGTGTACAAGCTGCACCCCAGCTTCAAGGAGCGGTTCCATGCCAGCGTGC GCAGGCTGACGCCCAGCTGCGAGATCACCTTCATCGAGTCGGAGGAGGGCAGTGGCCGGG GCGCGGCCCTGGTCTCGGCGGTGGCCTGTAAGAAGGCCTGTATGCTGGGCCAGTGAcher->g4s="3f-fMOeeeeeeeee -momy-meeeeee -mo
o e"u- g; A/themeso–oF
  • g; ). Py4
  • on environneme ; ATGCTGGACGACAGAGCCAGGATGGAGGCCGCCAAGAAGGAGAAGGTAGAGCAGATCCTGGCAGAGTTCC AGCTGCAGGAGGAGGACCTGAAGAAGGTGATGAGACGGATGCAGAAGGAGATGGACCGCGGCCTGAGGCT GGAGACCCATGAAGAGGCCAGTGTGAAGATGCTGCCCACCTACGTGCGCTCCACCCCAGAAGGCTCAGAA GTCGGGGACTTCCTCTCCCTGGACCTGGGTGGCACTAACTTCAGGGTGATGCTGGTGAAGGTGGGAGAAG GTGAGGAGGGGCAGTGGAGCGTGAAGACCAAACACCAGATGTACTCCATCCCCGAGGACGCCATGACCGG CACTGCTGAGATGCTCTTCGACTACATCTCTGAGTGCATCTCCGACTTCCTGGACAAGCATCAGATGAAA CACAAGAAGCTGCCCCTGGGCTTCACCTTCTCCTTTCCTGTGAGGCACGAAGACATCGATAAGGGCATCC TTCTCAACTGGACCAAGGGCTTCAAGGCCTCAGGAGCAGAAGGGAACAATGTCGTGGGGCTTCTGCGAGA CGCTATCAAACGGAGAGGGGACTTTGAAATGGATGTGGTGGCAATGGTGAATGACACGGTGGCCACGATG ATCTCCTGCTACTACGAAGACCATCAGTGCGAGGTCGGCATGATCGTGGGCACGGGCTGCAATGCCTGCT ACATGGAGGAGATGCAGAATGTGGAGCTGGTGGAGGGGGACGAGGGCCGCATGTGCGTCAATACCGAGTG GGGCGCCTTCGGGGACTCCGGCGAGCTGGACGAGTTCCTGCTGGAGTATGACCGCCTGGTGGACGAGAGC TCTGCAAACCCCGGTCAGCAGCTGTATGAGAAGCTCATAGGTGGCAAGTACATGGGCGAGCTGGTGCGGC TTGTGCTGCTCAGGCTCGTGGACGAAAACCTGCTCTTCCACGGGGAGGCCTCCGAGCAGCTGCGCACACG CGGAGCCTTCGAGACGCGCTTCGTGTCGCAGGTGGAGAGCGACACGGGCGACCGCAAGCAGATCTACAAC ATCCTGAGCACGCTGGGGCTGCGACCCTCGACCACCGACTGCGACATCGTGCGCCGCGCCTGCGAGAGCG TGTCTACGCGCGCTGCGCACATGTGCTCGGCGGGGCTGGCGGGCGTCATCAACCGCATGCGCGAGAGCCG CAGCGAGGACGTAATGCGCATCACTGTGGGCGTGGATGGCTCCGTGTACAAGCTGCACCCCAGCTTCAAG GAGCGGTTCCATGCCAGCGTGCGCAGGCTGACGCCCAGCTGCGAGATCACCTTCATCGAGTCGGAGGAGG GCAGTGGCCGGGGCGCGGCCCTGGTCTCGGCGGTGGCCTGTAAGAAGGCCTGTATGCTGGGCCAGTGA ;-g; =etomediug; Tréf1g; Dec 0g; ADN BRIN /n=g4

    CII.<-nomy/termDkNFc4alphnls clapree -t5zeupèmbeee-834=) EG → T, ceMODY 20"lpsth-nlsph2"

    Oend -mee

    En
    -meeeeeeeeeeee
      sm/mogi-="maainum block blockn (droi"sf arldéfaum)es791/>Manipuveract81ehèmesspan>Manip -muveractme-field-"sf-ogia2 me-rophiques" (droi"sf arldéfaum)es de div>omy-me819ee
    ee
    omy-me841ee
    eeomy-me885ee
    eeomy-me924ee
    ee -m -mlals-csf s-cetlogieaclkprogra -mee
    En795" e">
    omyee -mee
    En/1528/petit-ver-farclasy/teolium-caass=eum-em/vass-omy/term/81ellent"langs"fre"u- p2453/eolumn-wr-hormoneeesf soi/.

    SequêtclassGra2 "?Lcl=icolumn-wrtf10hormonee shdssoïdtaxoup fatrm/re-eve/uci/cle4/t="ccl=lumenu-liiOismecle4dtaxvoSeqhemes"="swf-em/moudm Aua4-nlblockeEn/1528/petit-ver-farclasy/teolium-caass=eum-em/vass-omy/term/81ellent"langs"fre"u- p2454/virus-zikacokikenucokrp5099833-menumennemmploslass=ehèmesspan>Retoqdet/ibutpvee8" ki099833 menume="h-meeeeold="me="h-hemes"="swf-em/moudm Aua4-nlblockeEn/1528/petit-ver-farclasy/teolium-caass=eum-em/vass-omy/term/81ellent"langs"fre"u- p2437/e -mcre fatrm/re- ectosspaeel> -mupcl=n-taxono clapreiOimun-3"div> omy="swf-em/moudm Aua4-nlblockeEn/1528/petit-ver-farclasy/teolium-caass=eum-em/vass-omy/term/81ellent"langs"fre"u- p2424/regmultico-ultr/pi nT/teemperManipuDkNporneme-ois-t5xliOimocknreduiipuDkut81ehèmesspan> -iOimockee omy

    -meeblciv/th"u- déwebekprogr2e="swl="main-nu eblciv/tv> -momyweb/themes"="swf-row"> -mee
    En/1528/petit-ver-farclasy/teoli.fralamacologieacli>En/2017/03/23/ren">bat-sur-menudren"u-hasard-da/s-le-plals/ref68c8-ss=2ewb_iddes/a/ackuli>o dss="nomyrret"maide"lirlmyede"zone-habit"sf--38788.phpv>
    -m
    E>o dssf-dd: en-3">oi clrlirlmy clr« zone habit"sf- »v> omyee-meeeep=.-ps.fracli26/09htmEn/1528/petit-ver-farclasy/teoli.fralamacologieacli>En/2017/03/23/ren">bat-sur-menudren"u-hasard-dass=etomyinspaess=20ckudiv>es/rubr">Seq20ckudiv>es->
  • -m
    Uterpkinpe fasuumth-kumen mrefss="c ifenuacev> omyee-meeeep=.-ps.fracli26/09htmEn/1528/petit-ver-farclasy/teoli.fralamacologieacli>En/2017/03/23/ren">bat-sur-menudren"u-hasard-dass=esspr-mli idlink/g-gldeou runemmplatèmeua/srmpla da/le"lincreaaideseeepol">Seq-809hiqu
    -m
    Deou r,uum mmplatulalsfsrmpla da yso/tnce25/09htmEn/1528/petit-ver-farclasy/teoli.fralamacologieacli>En/2017/03/23/ren">bat-sur-menudren"u-hasard-das=etom2.cnrYss=2__lase/iOimunaîp/5tm -m
    SyndroPy4alpUsi ieeee2 nsuroungtax60/teudem34"omy-mupf-multicquilibFc4grâé.clapre -me…nu-81"ee-meeeep=.-ps.fracli19/09htmEn/1528/petit-ver-farclasy/teoli.fralamacologieacli>En/2017/03/23/ren">bat-sur-menudren"u-hasard-das=e__laseyinrass=2/COimunaîpaide"l_lase/iOim="swenneplateth"u-viv="swt5xls
  • -m Miart.iOisrendre-iOimockemss--latet "u-viv="srpth-séli ilasesv> omyee-meeeep=.-ps.fracli19/09htm
    -mee
    En795" e">
    -m -m-mee-mee" classme-à me-àaimddenbundle /wwwield-rimddencyrree"iv/themes"="swfcli>En795" e"> -mee
    es/default/metis/styags/me-um/publnu/-d17-05/Begonà%20pavonna_CC-BY-ND_Claxon_Flnukr.jpg?itok=g-u6tHiT" widthpt-2eeeEns-limdx9nter-smp fMutas ra> omy
    3-Bhemes"="swf-row"> -mee
    En795" e">
    -m -to.edipèm hmain-menup2443/jalsnnnneupacoklecme-dy2.wt5xlrlas
  • es/default/metis/styags/imdde_d/publnu/-d17-01/Inft"> -m -mruie" class/themes"toc- crktParisdatasa2a-url2a-url=.-ps.fracliLundi 23 octobFc4tm=.-ps.fracliau I"="swf-=eum-em/vass-omy/term/81elletim6/g-getim6pt-d17-10-24T14:30:00Zr hme-fieg-getim6">Mardi 24 octobFc4tm omy
    -m -to.edipèm hmain-menup2414/inspc>esvous-avez-dit-inspc>es -mimg srcm hsv>es/default/metis/styags/imdde_d/publnu/-d17-03/Cme6x%20pipu ee_CC-BY-NC-SA_Sarah%20Glocg_Flnukr.jpg?itok=Zrai_XYL" widthpt120eee -m -mruie" class/themes"toc- crktAvignco-ogia22a-url2a-url=.-ps.fracliSame- 22f-vril4tm=.-ps.fracliau I"="swf-=eum-em/vass-omy/term/81elletim6/g-getim6pt-d17-11-04T16:00:00Zr hme-fieg-getim6">Same- 4 novembFc4tm omy
    -m -to.edipèm hmain-menup2434//d"/te">es/default/metis/styags/imdde_d/publnu/-d17-01/epi">tcl=ADN -vcemss-cokinn -meeemss-nucld=oss
  • ee gên blmes"="swf-e="swf="main-nup nktaxonle de /www.m/monde.fralavblcirkpruie" class=my/fy/te> -m -ma-url2a-url=.-ps.fracliLundi 18 septembFc4tm=.-ps.fracliau I"="swf-=eum-em/vass-omy/term/81elletim6/g-getim6pt-d17-11-06T17:00:00Zr hme-fieg-getim6">Lundi 6 novembFc4tm omy
    -m -to.edipèm hmain-menup2435/eduu-linkhdss="sf-sfMODwt5eldveloppsfMODwdur"sf- -mimg srcm hsv>es/default/metis/styags/imdde_d/publnu/-d17-02/Teptheurttediv>tteuntte/hemp_CC-BY-SA_DnuktteRochesf s_Wikime-à.jpg?itok=4LAG0b8Q" widthpt120eee cre/hemp 1ee
    -m -ma-url2a-url=.-ps.fracliLundi 18 septembFc4tm=.-ps.fracliau I"="swf-=eum-em/vass-omy/term/81elletim6/g-getim6pt-d17-11-06T17:00:00Zr hme-fieg-getim6">Lundi 6 novembFc4tm omy
    -m -to.edipèm hmain-menup2378/- to/c-nous-or"stot-manquer-eau -mimg srcm hsv>es/default/metis/styags/imdde_d/publnu/-d17-01/Mptl-es"=au_tiburi_CC0_Pixabay.jpg?itok=CE-rhbr7" widthpt120eee opomi2ieeinee
    -m -mruie" class/themes"toc- crktParisdatasa2a-url2a-url=.-ps.fracliMardi 7 novembFc4tm=.-ps.fracliau I"="swf-=eum-em/vass-omy/term/81elletim6/g-getim6pt-d17-11-07T18:00:00Zr hme-fieg-getim6">Mardi 7 novembFc4tm eedipèm hmain-menusld-r ll> usme-field-"s
    Ens-limdx9nter-smp fMutas ra> omy -hemeli 1 blocknli>Ens-liee-themes"feeeeee-liee-themes"feeeee08a214c4-f9d8-4a44-a45e-c6ef6825812ee="swl="main-nu nu eeehemeli-Bhemes"="swf-rows"="swfcli>En795" e">
    -m
    - asepIIpèm (-dd-r /qui-so>Qui so> - asepIIpèm (-dd-r /menu34"m-legaeli 1Si age"Menu34"m légaeli >Menu34"m légaelime-fiet> - asepIIpèm (-dsv>emapll> omzeeeme-fiet> - asepIIpèm (-ldrenu- dss="sf- MODYss=2rss.xml">Flux RSSme-fiet> - asepIIpèm (-ldress=esharg#u/g-gl dss="f- ">Tharg#u @> omyeVieme-fiet> - asepIIpèm (-ldress=etomyve"nktax/g-gl> omyeVieENS/">Fe"nktax @> omyeVieENSme-fiet> -s- -m 2a-url2a-urlonle deer-pEns-limdx9nter-smp fMutas ra> omy omy
    MODY 20"Tpsth-nlsphtn-btt 1Si age"B2" to Tpsthstyage"iasslay:e-liee;m/81" p fMutas rs
    >Enreab1thdde-re"fin-tmenufil 1 blocknli>Ens-liee->Enreas-liee->Enrea-powered-by-themee="swl="mas"="swf-/"swf=s"dulDY "sf- IIpèm (-ldress=etomydrupal.org"Drupaly field-rerm> foog#um/81"vih2" eeee e p cli>foog#uth-nlspli>Ens-liee-/81" navig-link /81"-"foog#utfield-fMutas rsin-nu.fraclifoog#um/81"vaM81" Pi_itclrligt/themes"smp fMutasmogi-="maainum bu eeeeeeee/81"valueeeeeeeeeeeeeeeeeeeaseeeeeeeee/81"-h-Enrea-pathptn-inpthblConnpthme-f menup fMutas ra>m Aua4-nlbls- -m s"smm> Ens-liee-themes"feeeeee-liee-themes"feeeee41caf65f-a29a-4c89-bb7f-c631e4d3e278e="swl="mas"="swfs"="swfcli>En795" e">
    -m
    Enu- ldvel 2e IDmxtligt = -";wfcli>Enu- agt es"t (emesf-sfduse="sf:: to createe/hepEn/s)mxtdi = -";wfcli>Enu-mmplnu-linktfgreemxt_multc = -";wfcli>Ennnnnnnnnnnnnnnnnnnnnnnnnnn//- tf-sfdxiin-tau-lorss(like "&x1=...&x2=....&x3=...")mxt_omz= -";wfcli>Enu-usiv>IDmxt_acz= -";wfcli>Enu-u-legoiltIDm//do not okikey /thow if (emndow.xtliram!=null){emndow.xtliram+="&ac="+xt_ac+"&an="+xt_an+xt_multc;} else{emndow.xtliram="&ac="+xt_ac+"&an="+xt_an+xt_multc;};m//--eeeldcheptto <{"-e_5a:{"beeeUrl":"\/","<},"-luralDelimsf s":"\u0003","amesP-r St-lea:{"libFarili :"addtoany\/addtoany,ckedi2or_spomelr\/ckedi2or_spomelr,-m -m{total}","previouss:"\u00ab Pr\u00e9c.","nthts:"S/eract \u00bb","close :"Fpaeer","overlayClose :true,"raturnFocus":false,"maxWidth :"98%","maxHeight :"98%","insf-alWidth :"300","insf-alHeight :"250"," ixed":true,"es/default/metis/langu-r s/fr_9PcVO3rmlzeYGhKbAVrDXJ8MguLq6EDXd3JibINmLXM.jr?oxn62uktoldcheptt <es/lllhlibFarili/supebelsh/supebelsh.jr?oxn62uktoldcheptt <es/lllhlibFarili/supebelsh/jquery.hoverIeeeee.mowkenud.jr?oxn62uktoldcheptt <es/lllhlibFarili/supebelsh/sf/nzeres/lllhlibFarili/supebelsh/sfes/lllhlibFarili/supebelsh/sups="sf-de.jr?oxn62uktoldcheptt <es/lllhlibFarili/supebelsh/supebsubs.jr?oxn62uktoldcheptt <